Stem-loop sequence egr-mir-4990

AccessionMI0017795 (change log)
DescriptionEchinococcus granulosus miR-4990 stem-loop
Literature search

1 open access papers mention egr-mir-4990
(2 sentences)

Stem-loop 
         u a      u       auucggaguauuucu 
5' gucucc c cggguu aaaccca               c
   |||||| | |||||| |||||||                
3' cggagg g gcucag uuugggu               c
         u -      -       aguaaccugugaaca
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM52419v1; GCA_000524195.1) Overlapping transcripts
APAU02000033.1: 147572-147647 [-]
intergenic
Database links

Mature sequence egr-miR-4990

Accession MIMAT0020251
Sequence

2 -  

ucuccucacggguuuaaacccaauu

 - 26

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:21219906 "Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes" Cucher M, Prada L, Mourglia-Ettlin G, Dematteis S, Camicia F, Asurmendi S, Rosenzvit M Int J Parasitol. 41:439-448(2011).
2
PMID:25656283 "microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach" Macchiaroli N, Cucher M, Zarowiecki M, Maldonado L, Kamenetzky L, Rosenzvit MC Parasit Vectors. 8:83(2015).