Stem-loop gma-MIR160b

Accession

MI0017821

Description

Glycine max gma-MIR160b precursor miRNA

Gene family

MIPF0000032; MIR160

Literature search

20 open access papers mention gma-MIR160b
(59 sentences)

Sequence

auguguaugUGCCUGGCUCCCUGUAUGCCauuugcauaguucauugagcaucaaugaucuuugugaauggcguaugaggagccaagcaua
.......(((((.(((((((.(((((((((((((((.((.(((((((...))))))).)).))))))))))))))).))))))).)))))

Structure

augugua     C       C               u  u       g 
       ugUGC UGGCUCC UGUAUGCCauuugca ag ucauuga  
       ||||| ||||||| ||||||||||||||| || ||||||| c
       auacg accgagg guaugcgguaagugu uc aguaacu  
-------     a       a               u  u       a 

Annotation confidence Not enough data

Genome context

chr20: 41668766-41668855 [+]

Mature gma-miR160b

• Accession: MIMAT0020970
• Description: Glycine max gma-miR160b mature miRNA
• Sequence: 10 - UGCCUGGCUCCCUGUAUGCC - 29
• Evidence: experimental ; 454 [1], Illumina [2]

References

1. PubMed ID: 21504877
   MicroRNAs in the shoot apical meristem of soybean
   "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
   "J Exp Bot (2011) 62:2495-2506


2. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153