Stem-loop sequence gma-MIR166c

AccessionMI0017829 (change log)
DescriptionGlycine max miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166c
(207 sentences)

Stem-loop 
   gcuu    uu   a        uu      cu       c  -ucuuc         --uu      a 
5'     ugug  uug ggggaaug  gucugg  cgaggac cu      uucuugauc    guguag c
       ||||  ||| ||||||||  ||||||  ||||||| ||      |||||||||    ||||||  
3'     auau  aac ccccuuac  cggacc  gcuuuug ga      aggaacugg    cauauc u
   ----    -u   c        uu      ag       u  uucgua         uguc      g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 4502830-4502959 [-]
intergenic
Database links

Mature sequence gma-miR166c-5p

Accession MIMAT0022980
Sequence

17 -  

ggaauguugucuggcucgagg

 - 37

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR166c-3p

Accession MIMAT0020978
Previous IDsgma-miR166c
Sequence

101 -  

ucggaccaggcuucauucccc

 - 121

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).