![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR171e |
|||||
Accession | MI0017839 (change log) | ||||
Description | Glycine max miR171e stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
16 open access papers mention gma-MIR171e | ||||
Stem-loop |
a u --- - a ucu a 5' ca ggg gauguugg acgguucaauca aucaaa ccua u || ||| |||||||| |||||||||||| |||||| |||| g 3' gu ccu cuauaacc ugccgaguuagu ugguuu gggu g c - aaa g a ccu c |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR171e |
|
Accession | MIMAT0020989 |
Sequence |
61 - ugauugagccgugccaauauc - 81 |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|