Stem-loop sequence gma-MIR171e

AccessionMI0017839 (change log)
DescriptionGlycine max miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

16 open access papers mention gma-MIR171e
(40 sentences)

Stem-loop 
   a  u   ---        -            a      ucu    a 
5'  ca ggg   gauguugg acgguucaauca aucaaa   ccua u
    || |||   |||||||| |||||||||||| ||||||   |||| g
3'  gu ccu   cuauaacc ugccgaguuagu ugguuu   gggu g
   c  -   aaa        g            a      ccu    c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 38773113-38773202 [-]
intergenic
Database links

Mature sequence gma-miR171e

Accession MIMAT0020989
Sequence

61 -  

ugauugagccgugccaauauc

 - 81

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).