Stem-loop sequence gma-MIR319f

AccessionMI0017844 (change log)
DescriptionGlycine max miR319f stem-loop
Literature search

17 open access papers mention gma-MIR319f
(43 sentences)

Stem-loop 
   ------aauua   u     g    u a     c    c  g  cu  auu 
5'            agg ggucu cuuc g uccaa gaug gg ag  gc   u
              ||| ||||| |||| | ||||| |||| || ||  ||    
3'            uuc ccggg gaag c agguu cugc cu uc  ug   a
   auacccuuuac   u     -    u -     -    a  g  ag  cug
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 48913063-48913157 [-]
intergenic
Database links

Mature sequence gma-miR319f

Accession MIMAT0020994
Sequence

65 -  

uuggacugaaggggccucuu

 - 84

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).