Stem-loop sequence gma-MIR408d

AccessionMI0017848 (change log)
Previous IDsgma-MIR408
DescriptionGlycine max miR408d stem-loop
Gene family MIPF0000102; MIR408
Literature search

16 open access papers mention gma-MIR408d
(53 sentences)

Stem-loop 
   -----a  -   -     c      a   c  a  g    auc      aaauggagaagugagaaau 
5'       ag gcu gggaa aggcag gca ga ug agcu   aacaga                   g
         || ||| ||||| |||||| ||| || || ||||   ||||||                    
3'       uc cgg cccuu uccguc cgu cu gc ucgg   uugucu                   a
   ucucug  u   u     c      a   a  c  a    -ga      agagagagaaagagaggag
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 47281670-47281799 [-]
intergenic
Database links

Mature sequence gma-miR408d

Accession MIMAT0020998
Previous IDsgma-miR408
Sequence

102 -  

ugcacugccucuucccuggc

 - 121

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).