Stem-loop sequence gma-MIR2118a

AccessionMI0017849 (change log)
DescriptionGlycine max miR2118a stem-loop
Gene family MIPF0000745; MIR2118
Literature search

15 open access papers mention gma-MIR2118a
(42 sentences)

Stem-loop 
   -aag          aa     u        g       a    a   -         -------------      --u      ---c    cu 
5'     ggaaagggag  gagcu gaggaagu augggag uggg ggg ucgguaaag             aauaua   cugaga    ucga  c
       ||||||||||  ||||| |||||||| ||||||| |||| ||| |||||||||             ||||||   ||||||    ||||  a
3'     ccuuucucuc  cuugg uuccuuua uauccuu accc ccu agccguuuu             uugugu   gacucu    agcu  a
   cuca          --     c        g       -    a   u         ccuauuuguuuug      ugu      cucu    cu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 36443544-36443713 [+]
intergenic
Database links

Mature sequence gma-miR2118a-5p

Accession MIMAT0022981
Sequence

34 -  

ggagaugggagggucgguaaag

 - 55

Get sequence
Evidence experimental; Illumina [3-4]

Mature sequence gma-miR2118a-3p

Accession MIMAT0020999
Previous IDsgma-miR2118a
Sequence

119 -  

uugccgauuccacccauuccu

 - 139

Get sequence
Evidence experimental; 454 [1], Illumina [2-4]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
4
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).