Stem-loop gma-MIR530a

Accession

MI0017852

Description

Glycine max gma-MIR530a precursor miRNA

Gene family

MIPF0000521; MIR530

Literature search

3 open access papers mention gma-MIR530a
(4 sentences)

Sequence

uugccuuuaucUGCAUUUGCACCUGCACUUUaauuacuugguuucucugugacauaaauaaauauaaauaugucagguaagagaaauauauuauauauaauaugggaauagagguaccgagaacgaggugcaggugcaucugcaggugaa
......(((((((((..((((((((((((((..((.((((((.(((((((..((((..((.((((((((((.((........)).)))).)))))).)).))))...))))))).)))))))).))))))))))))))..))))))))).

Structure

uugccu         UU              aa  a      u       -ga    aa  a      -    g  agg 
      uuaucUGCA  UGCACCUGCACUUU  uu cuuggu ucucugu   caua  ua auauaa auau uc   u
      |||||||||  ||||||||||||||  || |||||| |||||||   ||||  || |||||| |||| ||    
      aguggacgu  acguggacguggag  aa gagcca ggagaua   guau  au uauauu uaua ag   a
-----a         cu              -c  -      u       agg    -a  a      a    a  aga 

Annotation confidence Not enough data

Genome context

chr12: 33650621-33650770 [+]

Mature gma-miR530a

• Accession: MIMAT0021003
• Description: Glycine max gma-miR530a mature miRNA
• Sequence: 12 - UGCAUUUGCACCUGCACUUU - 31
• Evidence: experimental ; 454 [1], Illumina [2-3]

References

1. PubMed ID: 21504877
   MicroRNAs in the shoot apical meristem of soybean
   "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
   "J Exp Bot (2011) 62:2495-2506


2. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553


3. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153