![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR530a |
|||||
Accession | MI0017852 (change log) | ||||
Previous IDs | gma-MIR530 | ||||
Description | Glycine max miR530a stem-loop | ||||
Gene family | MIPF0000521; MIR530 | ||||
Literature search |
3 open access papers mention gma-MIR530a | ||||
Stem-loop |
uugccu uu aauua u -ga aa a - g agg 5' uuaucugca ugcaccugcacuuu cuuggu ucucugu caua ua auauaa auau uc u ||||||||| |||||||||||||| |||||| ||||||| |||| || |||||| |||| || 3' aguggacgu acguggacguggag gagcca ggagaua guau au uauauu uaua ag a -----a cu --caa u agg -a a a a aga |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR530a |
|
Accession | MIMAT0021003 |
Previous IDs | gma-miR530 |
Sequence |
12 - ugcauuugcaccugcacuuu - 31 |
Evidence | experimental; 454 [1], Illumina [2-3] |
References |
|
1 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|
3 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|