Stem-loop sequence gma-MIR530a

AccessionMI0017852 (change log)
Previous IDsgma-MIR530
DescriptionGlycine max miR530a stem-loop
Gene family MIPF0000521; MIR530
Literature search

3 open access papers mention gma-MIR530a
(4 sentences)

Stem-loop 
   uugccu         uu              aauua      u       -ga    aa  a      -    g  agg 
5'       uuaucugca  ugcaccugcacuuu     cuuggu ucucugu   caua  ua auauaa auau uc   u
         |||||||||  ||||||||||||||     |||||| |||||||   ||||  || |||||| |||| ||    
3'       aguggacgu  acguggacguggag     gagcca ggagaua   guau  au uauauu uaua ag   a
   -----a         cu              --caa      u       agg    -a  a      a    a  aga
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr12: 33650621-33650770 [+]
intergenic
Database links

Mature sequence gma-miR530a

Accession MIMAT0021003
Previous IDsgma-miR530
Sequence

12 -  

ugcauuugcaccugcacuuu

 - 31

Get sequence
Evidence experimental; 454 [1], Illumina [2-3]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
3
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).