Stem-loop sequence gma-MIR4994

AccessionMI0017860 (change log)
DescriptionGlycine max miR4994 stem-loop
Stem-loop
   ----------g              c             gu   a  g    
5'            guuagcucaaggau ucacaugauccag  gga uu auc 
              |||||||||||||| |||||||||||||  ||| || || a
3'            uaaucgaguuccua aguguacuagguu  ccu ag ugg 
   guacuaucaca              u             --   a  g    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 36093877-36093967 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR4994
gma-MIR9739chr16: 36092901-36093006 [+]
gma-MIR4994chr16: 36093877-36093967 [+]
Database links

Mature sequence gma-miR4994-5p

Accession MIMAT0021012
Previous IDsgma-miR4994
Sequence

1 - 

gguuagcucaaggaucucac

 - 20

Get sequence
Evidence experimental; 454 [1]

Mature sequence gma-miR4994-3p

Accession MIMAT0032119
Sequence

63 - 

ugauauccuugagcuaauaca

 - 83

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2