Stem-loop sequence gma-MIR4996

AccessionMI0017862 (change log)
DescriptionGlycine max miR4996 stem-loop
Literature search

4 open access papers mention gma-MIR4996
(6 sentences)

Stem-loop 
   uuucuc     uu            uaa          u      - u  cc cuu u    ca    ---ua       cuuuaaacuuccuuuuuca 
5'       cuaac  ugagagcauggg   cuucuauuuu uuggcg c gu  c   c ccau  ucuu     cuucaac                   a
         |||||  ||||||||||||   |||||||||| |||||| | ||  |   | ||||  ||||     |||||||                    
3'       gauug  acucuuguaccc   gaagauaaga gaccgu g cg  g   g ggua  agaa     ggaguug                   c
   -----c     cc            cuc          c      a c  uu uuu -    aa    uuaaa       uaucaguccuuaaaauuau
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 5437428-5437617 [+]
intergenic
Database links

Mature sequence gma-miR4996

Accession MIMAT0021014
Sequence

162 -  

uagaagcuccccauguucuc

 - 181

Get sequence
Evidence experimental; 454 [1], Illumina [2-3]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
3
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).