Stem-loop gma-MIR4996

Accession

MI0017862

Description

Glycine max gma-MIR4996 precursor miRNA

Literature search

4 open access papers mention gma-MIR4996
(6 sentences)

Sequence

uuucuccuaacuuugagagcauggguaacuucuauuuuuuuggcgcuguccccuucuccaucaucuuuacuucaaccuuuaaacuuccuuuuucaacuauuaaaauuccugacuauguugaggaaauuaagaaaauggguuuguugccgaugccagcagaaUAGAAGCUCCCCAUGUUCUCaccguuagc
......(((((..((((((((((((...((((((((((.(((((((.((......(.((((..((((..(((((((........................................))))))).....))))..)))))......)).).)))))).))))))))))...))))))))))))..))))).

Structure

uuucuc     uu            uaa          u      - u  ccccuu u    ca    ---ua       cuuuaaacuuccuuuuuca 
      cuaac  ugagagcauggg   cuucuauuuu uuggcg c gu      c ccau  ucuu     cuucaac                   a
      |||||  ||||||||||||   |||||||||| |||||| | ||      | ||||  ||||     |||||||                    
      gauug  aCUCUUGUACCC   GAAGAUaaga gaccgu g cg      g ggua  agaa     ggaguug                   c
-----c     cc            CUC          c      a c  uuguuu -    aa    uuaaa       uaucaguccuuaaaauuau 

Annotation confidence Not enough data

Genome context

chr15: 5437428-5437617 [+]

Mature gma-miR4996

• Accession: MIMAT0021014
• Description: Glycine max gma-miR4996 mature miRNA
• Sequence: 162 - UAGAAGCUCCCCAUGUUCUC - 181
• Evidence: experimental ; 454 [1], Illumina [2-3]

References

1. PubMed ID: 21504877
   MicroRNAs in the shoot apical meristem of soybean
   "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
   "J Exp Bot (2011) 62:2495-2506


2. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553


3. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153