Stem-loop sequence ath-MIR5022

AccessionMI0017891 (change log)
DescriptionArabidopsis thaliana miR5022 stem-loop
Stem-loop
   --    -a        a            u             u     cucau       g 
5'   guau  aacuagaa acugucaugggg augaucgaauguu gugua     uuuucgu g
     ||||  |||||||| |||||||||||| ||||||||||||| |||||     |||||||  
3'   uaua  uugaucuu ugauaguaccuc uacuaguuuacaa cguau     agaagua a
   ua    gc        a            u             -     -----       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 22372462-22372578 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR5022
ath-MIR5022chr1: 22372462-22372578 [+]
ath-MIR4227chr1: 22372670-22372790 [+]
Database links

Mature sequence ath-miR5022

Accession MIMAT0020527
Sequence

18 - 

gucaugggguaugaucgaaug

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).