Stem-loop sequence gma-MIR5041

Accession

MI0017920 (change log)

Description

Glycine max miR5041 stem-loop

Literature search

2 open access papers mention gma-MIR5041
(2 sentences)

Stem-loop

   agaaacuuaaaguuguuggugcuagcaccaaucaaguguccuuuc  c        a   u                         cacucaa 
5'                                              cg guucucga aac uucaucuucaacuugcucaacggua       g
                                                || |||||||| ||| |||||||||||||||||||||||||        
3'                                              gc caagggcu uug aaguagaaguugaacgaguugcuau       u
   ------------------------------------uaccuguaa  -        g   u                         acuaaua 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Glycine_max_v2.0; GCA_000004515.3): chr16: 30479426-30479576 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0017920

Mature sequence gma-miR5041-5p

• Accession: MIMAT0021070
• Previous IDs: gma-miR5041
• Sequence: 61 - uuucaucuucaacuugcucaa - 81
• Evidence: experimental; SOLiD [1]

Mature sequence gma-miR5041-3p

• Accession: MIMAT0032122
• Sequence: 107 - guugagcaaguugaagaugaa - 127
• Evidence: experimental; Illumina [2]

References

1. PMID:21751852 "Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome" Radwan O, Liu Y, Clough SJ Mol Plant Microbe Interact. 24:958-972(2011).
2. PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).