![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR5042 |
|||||
Accession | MI0017922 (change log) | ||||
Description | Glycine max miR5042 stem-loop | ||||
Stem-loop |
aaagaugcaaaauuuucaaguguucaaguguugacaacuauuuuuagcuuucaaaccc c ---- au 5' ccuaucuuggauca agccccauu gccu c |||||||||||||| ||||||||| |||| 3' ggauagaaccuagu ucgggguga cggg a ------------------------------gucaaguaugaaaguucgaaaggucgaa - gguu gu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR5042-5p |
|
Accession | MIMAT0021072 |
Previous IDs | gma-miR5042 |
Sequence |
61 - uaucuuggaucacagccccauu - 82 |
Evidence | experimental; SOLiD [1] |
Mature sequence gma-miR5042-3p |
|
Accession | MIMAT0032123 |
Sequence |
103 - uggggcuugauccaagauagg - 123 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"
Mol Plant Microbe Interact. 24:958-972(2011).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|