Stem-loop sequence hvu-MIR399

AccessionMI0017933 (change log)
DescriptionHordeum vulgare miR399 stem-loop
Literature search

9 open access papers mention hvu-MIR399
(238 sentences)

Stem-loop
   ucagaagaacua         g  aaa  -           acuauagguacuguagguagguuu 
5'             gguagauuu cc   gg agauuugccga                        u
               ||||||||| ||   || |||||||||||                        g
3'             ccguuuaga gg   cc uuuggauggcu                        c
   auucaagaagcc         -  aaa  g           aucaagccccguuuagaggaaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR399

Accession MIMAT0020542
Sequence

102 - 

ugccaaaggagauuugccccg

 - 122

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).