Stem-loop sequence bdi-MIR169i

AccessionMI0018080 (change log)
DescriptionBrachypodium distachyon miR169i stem-loop
Gene family MIPF0000832; MIR169_5
Literature search

3 open access papers mention bdi-MIR169i
(27 sentences)

Stem-loop
   --uggagacgaggagccccuuugcagg    a c        a       c      --c     u  gu          cu      aa 
5'                            cucu c agccaaga uggcuug cuaugc   cacgu cu  uucaucacca  gggcuu  u
                              |||| | |||||||| ||||||| ||||||   ||||| ||  ||||||||||  ||||||  c
3'                            gaga g ucgguucu accgaac gguaug   gugua ga  agguaguggu  cccgag  u
   cgucggaucguacccccugcuccuaga    a a        -       u      uua     -  gu          --      gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 44509037-44509211 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR169i
bdi-MIR169i4: 44509037-44509211 [+]
bdi-MIR169j4: 44513754-44513936 [+]
Database links

Mature sequence bdi-miR169i

Accession MIMAT0020655
Sequence

31 - 

ccagccaagaauggcuugccua

 - 52

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).