Stem-loop sequence bdi-MIR171b

AccessionMI0018084 (change log)
DescriptionBrachypodium distachyon miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

1 open access papers mention bdi-MIR171b
(2 sentences)

Stem-loop
   ---cca   a  a   uacu   -u     ag                        a  c      ucucug   -   cug     c 
5'       agg uu cua    ggc  gggag  ugcgauguuggcacgguucaauca au gggugg      cau gca   gcuug g
         ||| || |||    |||  |||||  |||||||||||||||||||||||| || ||||||      ||| |||   |||||  
3'       ucc aa gau    ccg  ucuuc  acgcuauaaccgugccgaguuagu ua cucgcu      gua cgu   cgaac a
   gccaug   -  c   ----   uu     ga                        c  c      -uugua   g   ---     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 6911133-6911296 [+]
intergenic
Database links

Mature sequence bdi-miR171b

Accession MIMAT0020659
Sequence

114 - 

ugauugagccgugccaauauc

 - 134

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).