Stem-loop sequence bdi-MIR398a

AccessionMI0018116 (change log)
DescriptionBrachypodium distachyon miR398a stem-loop
Gene family MIPF0000107; MIR398
Literature search

3 open access papers mention bdi-MIR398a
(4 sentences)

Stem-loop
   --aagaa  ga   ca    -  a     uu  u      u   a             agauggaugguccgcuga 
5'        ca  cag  caug cg ggaag  cc gcaggg cga uugggaacacaug                  g
          ||  |||  |||| || |||||  || |||||| ||| |||||||||||||                   
3'        gu  guu  guac gu ccuuc  gg uguccc gcu gacucuuguguac                  c
   uccguua  -a   ag    c  g     ug  u      c   g             cggcucgagcucgagucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 35924413-35924562 [-]
intergenic
Database links

Mature sequence bdi-miR398a

Accession MIMAT0020691
Sequence

96 - 

uguguucucaggucgccccug

 - 116

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).