Stem-loop sequence bdi-MIR398b

AccessionMI0018150 (change log)
DescriptionBrachypodium distachyon miR398b stem-loop
Gene family MIPF0000107; MIR398
Literature search

3 open access papers mention bdi-MIR398b
(4 sentences)

Stem-loop
   ------------ggaugggaugc   ug        ug      c   a   u a            g   a     c  ugc    ug 
5'                        aau  agggaagc  aaccca agg gug c cugagaacacag ugc gaugc aa   augg  a
                          |||  ||||||||  |||||| ||| ||| | |||||||||||| ||| ||||| ||   ||||  g
3'                        uua  ucccuucg  uugggu ucc cac g gacucuuguguu acg cuacg uu   uacu  u
   guacuguguauuggaccgguacc   gu        --      u   c   u -            a   -     u  --u    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 21918225-21918387 [+]
intergenic
Database links

Mature sequence bdi-miR398b

Accession MIMAT0020726
Sequence

33 - 

caggagugucacugagaacaca

 - 54

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).