Dead miRNA entry

miRNA accession:
MI0018218
miRNA ID:
bdi-MIR395i
Forward to:
MI0018088
Comment:
Two previously annotated MIR395 entries map to the same locus in the v1.0 genome assembly, and so are merged.

Previous miRNA entry

Stem-loop sequence bdi-MIR395i

AccessionMI0018218 (change log)
DescriptionBrachypodium distachyon miR395i stem-loop
Stem-loop
   u   au     u  a      a              ga    auu 
5'  ggu  uauca ga uucccu caagcacuucacaa  agcu   c
    |||  ||||| || |||||| ||||||||||||||  ||||    
3'  cca  guagu cu aagggg guuugugaaguguu  ucgg   c
   a   cu     u  c      -              -a    gau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bdi-miR395i

Accession MIMAT0020743
Sequence

59 - 

gugaaguguuugggggaacu

 - 78

Get sequence
Evidence experimental;

References

1