Dead miRNA entry

miRNA accession:
MI0018228
miRNA ID:
bdi-MIR398c
Forward to:
MI0018116
Comment:
Two previously annotated MIR398 entries map to the same locus in the v1.0 genome assembly, and so are merged.

Previous miRNA entry

Stem-loop sequence bdi-MIR398c

AccessionMI0018228 (change log)
DescriptionBrachypodium distachyon miR398c stem-loop
Stem-loop
      ca    -  a     uu  u      u   a             agauggaugguccgcuga 
5' cag  caug cg ggaag  cc gcaggg cga uugggaacacaug                  g
   |||  |||| || |||||  || |||||| ||| |||||||||||||                   
3' guu  guac gu ccuuc  gg uguccc gcu gacucuuguguac                  c
      ag    c  g     ug  u      c   g             cggcucgagcucgagucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bdi-miR398c

Accession MIMAT0020753
Sequence

87 - 

auguguucucaggucgccccu

 - 107

Get sequence
Evidence experimental;

References

1