Stem-loop sequence mtr-MIR5281a

AccessionMI0018423 (change log)
DescriptionMedicago truncatula miR5281a stem-loop
Gene family MIPF0000875; MIR2593
Stem-loop
   uu   -ac                             -      a                      g       cuaaucaag 
5'   gug   auacucccuucgguccuauuuacaagaga aauuug cuuuuuagauacauuaaauaau uauguau         a
     |||   ||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |||||||         a
3'   cau   ugugagggaggcuaggauaaauguucucu uuaaau gaaaaaucuauguaauuuauua auacaua         u
   cu   aua                             g      -                      a       aaccaaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 20624516-20624683 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR5281a
mtr-MIR5281achr8: 20624516-20624683 [+]
mtr-MIR2619achr8: 20630374-20630622 [+]
Database links

Mature sequence mtr-miR5281a

Accession MIMAT0021320
Sequence

133 - 

cucuuguaaauaggaucggaggga

 - 156

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).