Stem-loop sequence osa-MIR2275c

Accession

MI0019032 (change log)

Description

Oryza sativa miR2275c stem-loop

Gene family

MIPF0000797; MIR2275

Literature search

14 open access papers mention osa-MIR2275c
(70 sentences)

Stem-loop

   a     a      -               a    u  c      -a    u   a 
5'  cugga gugaga auuggaggaaaacaa cuga ug ugguug  ugcu gca c
    ||||| |||||| ||||||||||||||| |||| || ||||||  |||| |||  
3'  gacuu cacucu uaaccucuuuuuguu gacu au auuaac  acgg ugu a
   g     c      a               a    u  a      aa    -   g 

Deep sequencing

1 reads, 0 reads per million, 1 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr7: 16719772-16719880 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0019032

Mature sequence osa-miR2275c

• Accession: MIMAT0022147
• Sequence: 11 - agaauuggaggaaaacaaacuga - 33
• Deep sequencing: 1 reads, 1 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:21679406 "Deep sequencing on genome-wide scale reveals the unique composition and expression patterns of microRNAs in developing pollen of Oryza sativa" Wei LQ, Yan LF, Wang T Genome Biol. 12:R53(2011).