![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sbi-MIR5568a |
|||||
Accession | MI0019103 (change log) | ||||
Previous IDs | sbi-MIR5568 | ||||
Description | Sorghum bicolor miR5568 stem-loop | ||||
Gene family | MIPF0001377; MIR5568 | ||||
Literature search |
2 open access papers mention sbi-MIR5568a | ||||
Stem-loop |
ucccaaca a g u c gg
5' uuccaaauuguaagucguucuggcuuuucua gua au g ugu c
||||||||||||||||||||||||||||||| ||| || | |||
3' aagguuuaacauucagcgagaccgagaagau uau ua c acg u
----uaac g g u c ua
|
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sbi-miR5568a |
|
Accession | MIMAT0022248 |
Previous IDs | sbi-miR5568 |
Sequence |
81 - cagagcgacuuacaauuugga - 101 |
Evidence | experimental; 454 [1] |
References |
|
1 |
PMID:21907786
"Identification and temporal expression analysis of conserved and novel microRNAs in Sorghum"
Genomics. 98:460-468(2011).
|