![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-5100 |
|||||
Accession | MI0019116 (change log) | ||||
Symbol | HGNC:MIR5100 | ||||
Description | Homo sapiens miR-5100 stem-loop | ||||
Literature search |
4 open access papers mention hsa-mir-5100 | ||||
Stem-loop |
ccaugagg a --- ----a --- gga g cu g ga 5' agcuggc gu ggg uggcc ugggggua gc ugg ucugga cua c ||||||| || ||| ||||| |||||||| || ||| |||||| ||| c 3' ucgacug cg ucc accgg aucuccgu cg acc agacuu ggu a -------- a ggu aggac uca -gg - cu g ac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-5100 |
|
Accession | MIMAT0022259 |
Sequence |
68 - uucagaucccagcggugccucu - 89 |
Deep sequencing | 46891 reads, 152 experiments |
Evidence | experimental; SOLiD [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:21895886
"Deep sequencing of short RNAs reveals novel microRNAs in minor salivary glands of patients with Sjogren's syndrome"
Oral Dis. 18:127-131(2012).
|