Stem-loop sequence vun-MIR169

AccessionMI0019572 (change log)
DescriptionVigna unguiculata miR169 stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

3 open access papers mention vun-MIR169
(8 sentences)

Stem-loop
   ---aac       --    c          g           -uua     cau  u 
5'       agagagu  gaug agccaaggau acuugccggcg    ugcug   ga g
         |||||||  |||| |||||||||| |||||||||||    |||||   ||  
3'       uuucucg  uugc ucgguucuug ugaacggccgu    gcggc   uu c
   ucuucu       gu    a          g           uuca     auu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence vun-miR169

Accession MIMAT0022759
Sequence

15 - 

cagccaaggaugacuugccgg

 - 35

Get sequence
Evidence experimental; cloned [1]

References

1
"Identification and validation of conserved microRNAs along with their differential expression in roots of Vigna unguiculata grown under salt stress" Paul S, Kundu A, Pal A Plant Cell Tissue Organ Culture. 105:233-242(2011).