Dead miRNA entry

miRNA accession:
MI0019590
miRNA ID:
dre-mir-725-2
Forward to:
MI0004769
Comment:
The sequences previously named mir-725-1 and mir-725-2 map to the same locus in the GRCz10 genome assembly. The entries are therefore merged.

Previous miRNA entry

Stem-loop sequence dre-mir-725-2

AccessionMI0019590 (change log)
DescriptionDanio rerio miR-725-2 stem-loop
Gene family MIPF0001355; mir-725
Stem-loop
            a            ug           gaag 
5' cugcagugc cauugcuaggaa  guggcugagau    a
   ||||||||| ||||||||||||  |||||||||||     
3' gacgucgcg gugaugaucuuu  uacugacuuua    g
            c            gu           ggac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dre-miR-725-5p

Accession MIMAT0032010
Sequence

14 - 

ugcuaggaaugguggcugagau

 - 35

Get sequence
Deep sequencing577 reads, 11 experiments
Evidence not experimental

Mature sequence dre-miR-725-3p

Accession MIMAT0003753
Previous IDsdre-miR-725
Sequence

48 - 

uucagucauuguuucuaguagu

 - 69

Get sequence
Deep sequencing72068 reads, 11 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).