Stem-loop sequence mtr-MIR5037b

AccessionMI0019696 (change log)
DescriptionMedicago truncatula miR5037b stem-loop
Gene family MIPF0001288; MIR5037
Stem-loop
   -   a   a u     uca   -           a   -ag   c 
5'  agc uuc g aaccc   aag gcuuccacggc uca   uua a
    ||| ||| | |||||   ||| ||||||||||| |||   |||  
3'  ucg aag c uuggg   uuc ugaaggugcug agu   aau u
   u   g   c u     uuc   g           a   gua   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 23954301-23954389 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR5037b
mtr-MIR5037cchr7: 23961112-23961230 [-]
mtr-MIR5206bchr7: 23959036-23959156 [-]
mtr-MIR5037bchr7: 23954301-23954389 [-]
mtr-MIR5037achr7: 23948126-23948212 [-]
Database links

Mature sequence mtr-miR5037b

Accession MIMAT0023151
Sequence

11 - 

aacccucaaaggcuuccacgg

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).