Stem-loop sequence mtr-MIR5037c

AccessionMI0019698 (change log)
DescriptionMedicago truncatula miR5037c stem-loop
Gene family MIPF0001288; MIR5037
Stem-loop
   ---aa  uaaa    -gu    a   a u     uc   g           accaag      g 
5'      gu    agga   aagc uuc g aaccc  aaa gcuuccacggc      uuacau u
        ||    ||||   |||| ||| | |||||  ||| |||||||||||      ||||||  
3'      cg    uccu   uucg aag c uuggg  uuu ugaaggugcug      agugua a
   uccua  --ua    aau    g   c u     uu   g           -----a      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 23961112-23961230 [-]
intergenic
contig_70603: 886-1004 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR5037c
mtr-MIR5204chr7: 23966861-23966946 [+]
mtr-MIR5037cchr7: 23961112-23961230 [-]
mtr-MIR5206bchr7: 23959036-23959156 [-]
mtr-MIR5037bchr7: 23954301-23954389 [-]
Database links

Mature sequence mtr-miR5037c

Accession MIMAT0023153
Sequence

26 - 

aacccucaaaggcuuccacgg

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).