Stem-loop sequence gma-MIR1516c

AccessionMI0019723 (change log)
DescriptionGlycine max miR1516c stem-loop
Literature search

1 open access papers mention gma-MIR1516c
(1 sentences)

Stem-loop 
   uga   ug   a g   gg       g      u a             cuuuu   uuu  u 
5'    uca  gca u ucu  gcuuagc aggcgg c cgagcuuagcgug     ggg   cu c
      |||  ||| | |||  ||||||| |||||| | |||||||||||||     |||   ||  
3'    agu  cgu g agg  cgaaucg uccguu g guucgaaucgugc     ucc   gg a
   ccg   ug   - g   ag       -      c a             -uucu   --u  u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 40141067-40141189 [+]
intergenic
Database links

Mature sequence gma-miR1516c

Accession MIMAT0023178
Sequence

11 -  

aaugucugggcuuagcgaggcggu

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).