![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR5774b |
|||||
Accession | MI0019738 (change log) | ||||
Description | Glycine max miR5774b stem-loop | ||||
Gene family | MIPF0001567; MIR5774 | ||||
Literature search |
1 open access papers mention gma-MIR5774b | ||||
Stem-loop |
aa ------ a g agg u agcu
5' gaguuugggcuggcgucgacacguggcaugagacuagucagu ggc auuugcag uagc gcu cuc u
|||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |||| ||| |||
3' cucaaacccgacugcagcugugcacuguacucugaucgguca ccg uaaacguc auug cga ggg u
ug gguuaa c - gga u acuu
|
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR5774b |
|
Accession | MIMAT0023193 |
Sequence |
11 - gcuggcgucgacacguggcau - 31 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|