Stem-loop sequence gma-MIR172k

Accession

MI0019746 (change log)

Description

Glycine max miR172k stem-loop

Gene family

MIPF0000035; MIR172

Literature search

27 open access papers mention gma-MIR172k
(123 sentences)

Stem-loop

   uuguuu  g         c             a   ----     aa       g  a uau  u   au 
5'       gc gauguagca caucaagauucac ugc    aaaug  ggugggu gg c   ga gca  c
         || ||||||||| ||||||||||||| |||    |||||  ||||||| || |   || |||  u
3'       cg cuacgucgu guaguucuaagug gug    uuuau  uuaccua cc g   cu cgu  a
   aaauac  a         a             -   guuu     gg       a  - --u  -   ga 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Glycine_max_v2.0; GCA_000004515.3): chr12: 33517484-33517617 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0019746

Mature sequence gma-miR172k

• Accession: MIMAT0023201
• Sequence: 104 - ugaaucuugaugaugcugcau - 124
• Evidence: experimental; Illumina [1]

References

1. PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).