![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR172k |
|||||
Accession | MI0019746 (change log) | ||||
Description | Glycine max miR172k stem-loop | ||||
Gene family | MIPF0000035; MIR172 | ||||
Literature search |
![]()
27 open access papers mention gma-MIR172k | ||||
Stem-loop |
uuguuu g c a ---- aa g a uau u au 5' gc gauguagca caucaagauucac ugc aaaug ggugggu gg c ga gca c || ||||||||| ||||||||||||| ||| ||||| ||||||| || | || ||| u 3' cg cuacgucgu guaguucuaagug gug uuuau uuaccua cc g cu cgu a aaauac a a - guuu gg a - --u - ga |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR172k |
|
Accession | MIMAT0023201 |
Sequence |
104 - ugaaucuugaugaugcugcau - 124 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|