![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR171o |
|||||
Accession | MI0019749 (change log) | ||||
Description | Glycine max miR171o stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
16 open access papers mention gma-MIR171o | ||||
Stem-loop |
u --g u a a c u ug 5' aag gc ug gauauugguacgguucaaucaga ga ag gcuuua a ||| || || ||||||||||||||||||||||| || || |||||| 3' uuc cg ac cuauaaccgugccgaguuaguuu uu uc cgaaau u u aaa u a a c u cu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR171o-5p |
|
Accession | MIMAT0032131 |
Sequence |
11 - agauauugguacgguucaauc - 31 |
Evidence | experimental; Illumina [2] |
Mature sequence gma-miR171o-3p |
|
Accession | MIMAT0023204 |
Previous IDs | gma-miR171o |
Sequence |
72 - uugagccgugccaauaucaca - 92 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|