Stem-loop sequence hco-mir-5894a

AccessionMI0020010 (change log)
DescriptionHaemonchus contortus miR-5894a stem-loop
Literature search

1 open access papers mention hco-mir-5894a
(1 sentences)

Stem-loop
   --cagaaaaa     u     -   c     u                 au 
5'           guaag guggu aag cuaua cugaugguguagcggga  u
             ||||| ||||| ||| ||||| |||||||||||||||||  c
3'           uauuc caucg uuc gguau gacuaccacaucgcucu  u
   guguaaucaa     -     g   a     u                 gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5894a

Accession MIMAT0023334
Sequence

23 - 

ccuauaucugaugguguagcggga

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).