Stem-loop sequence hco-mir-124

AccessionMI0020014 (change log)
DescriptionHaemonchus contortus miR-124 stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention hco-mir-124
(1 sentences)

Stem-loop
   ---ccguauc      -gga      c  u       -   a       -  g 
5'           gacgcu    ucgcuu gc uucaucg gug cuuuagu gu a
             ||||||    |||||| || ||||||| ||| ||||||| || a
3'           uugcga    agcgaa cg aaguggc cac ggaauca cg a
   uccuccuucu      aaua      c  u       g   -       a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-124

Accession MIMAT0023338
Sequence

57 - 

uaaggcacgcggugaaugccaa

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).