Stem-loop sequence hco-mir-86

AccessionMI0020025 (change log)
DescriptionHaemonchus contortus miR-86 stem-loop
Gene family MIPF0000247; mir-86
Literature search

1 open access papers mention hco-mir-86
(2 sentences)

Stem-loop
   -----uu  gca a   a   a     -         g   u   a   u    ga 
5'        ug   g gcg ccc ccagu uaagugaau cuu gcc cag cuua  c
          ||   | ||| ||| ||||| ||||||||| ||| ||| ||| ||||  a
3'        ac   c cgc ggg ggucg auucgcuug gag cgg guc gaau  u
   cugggcu  -ag -   -   a     g         -   c   -   -    gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-86

Accession MIMAT0023350
Sequence

23 - 

uaagugaaugcuuugccacagucu

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).