Stem-loop sequence hco-mir-7

AccessionMI0020059 (change log)
DescriptionHaemonchus contortus miR-7 stem-loop
Literature search

1 open access papers mention hco-mir-7
(2 sentences)

Stem-loop
   -   -u     a    -    a  a       u  uu cac 
5'  ggu  gccga ugga agac gg gauugcg cg  g   u
    |||  ||||| |||| |||| || ||||||| ||  |    
3'  uca  cggcu gccu ucug cc cuaacgu gc  c   u
   g   cu     a    a    c  -       c  uc acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-7

Accession MIMAT0023387
Sequence

11 - 

uggaagacaggagauugcgucgu

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).