Stem-loop sequence hco-mir-5894b

AccessionMI0020071 (change log)
DescriptionHaemonchus contortus miR-5894b stem-loop
Literature search

1 open access papers mention hco-mir-5894b
(1 sentences)

Stem-loop
   uauuuuua       -         u      ua 
5'         cuguugc uuaucagau auaggu  g
           ||||||| ||||||||| ||||||  c
3'         ggcgaug gguagucua uauccg  u
   agagcaaa       u         -      ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5894b

Accession MIMAT0023400
Sequence

39 - 

gccuauaucugaugguguagc

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).