Stem-loop sequence hco-mir-1

AccessionMI0020072 (change log)
DescriptionHaemonchus contortus miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

1 open access papers mention hco-mir-1
(2 sentences)

Stem-loop
   cuugguaauccauacgcu       u               ac     -  gu 
5'                   ucagacu cgugcuucuuugcau  ccaua cu  a
                     ||||||| |||||||||||||||  ||||| ||   
3'                   gguuuga guaugaagaaaugua  gguau gg  u
   -------------uuacc       u               -a     a  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-1

Accession MIMAT0023401
Sequence

62 - 

uggaauguaaagaaguauguag

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).