Stem-loop sequence hco-mir-2

AccessionMI0020084 (change log)
DescriptionHaemonchus contortus miR-2 stem-loop
Gene family MIPF0000049; mir-2
Literature search

1 open access papers mention hco-mir-2
(3 sentences)

Stem-loop
   -----cu     caaca   gc              -    gg     u  ucga 
5'        guccu     ccg  acggcacgucaaag uggu  gugau ug    c
          |||||     |||  |||||||||||||| ||||  ||||| ||     
3'        cgggg     ggu  ugucguguaguuuc accg  cacua ac    u
   cucucug     aaacg   aa              g    -a     u  ucgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-2

Accession MIMAT0023415
Sequence

58 - 

uaucacagccagcuuugaugugc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).