Stem-loop sequence hco-mir-190

AccessionMI0020171 (change log)
DescriptionHaemonchus contortus miR-190 stem-loop
Literature search

1 open access papers mention hco-mir-190
(1 sentences)

Stem-loop
   ----------------------accaccauaa    a   -         cuc  ua   g  u 
5'                                 ggau ugu augggugag   gu  gag gu u
                                   |||| ||| |||||||||   ||  ||| ||  
3'                                 ccua aca ugcccacuu   ca  cuc ca u
   cucaaaaaguggccauggcaauaccuaaguga    g   g         --c  --   g  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-190-5p

Accession MIMAT0023502
Sequence

11 - 

ggauauguaugggugagcucguu

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).