Stem-loop sequence ame-mir-6000a

AccessionMI0020210 (change log)
DescriptionApis mellifera miR-6000 stem-loop
Stem-loop
   ucaga    cg        a  a  c         a     cu     ucau 
5'      uacu  ugguggug cg cu guggguacu cucgu  cuaua    c
        ||||  |||||||| || || ||||||||| |||||  |||||     
3'      auga  acuacuac gc ga cacccauga gagca  gauau    a
   ----a    --        -  a  a         a     -u     uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000057.5: 11872162-11872259 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-6000a
ame-mir-6040CM000057.5: 11872753-11872831 [-]
ame-mir-6000bCM000057.5: 11872166-11872246 [+]
ame-mir-6000aCM000057.5: 11872162-11872259 [-]
Database links

Mature sequence ame-miR-6000a-5p

Accession MIMAT0023539
Sequence

26 - 

cguggguacuacucgucucuau

 - 47

Get sequence
Evidence experimental; SOLiD [1], Illumina [3]

Mature sequence ame-miR-6000a-3p

Accession MIMAT0023540
Sequence

61 - 

uaguacgagaaguacccaca

 - 80

Get sequence
Evidence experimental; SOLiD [1], Illumina [3]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).