Stem-loop sequence ame-mir-6005

AccessionMI0020215 (change log)
DescriptionApis mellifera miR-6005 stem-loop
Stem-loop
   cgcac          ---       a     ga   ucagcaac   ag                 a          c    uua 
5'      ugucgacuag   ucgucaa gauua  ucg        uua  uuuaagagaacauauga cucuuaugua guga   c
        ||||||||||   ||||||| |||||  |||        |||  ||||||||||||||||| |||||||||| ||||    
3'      auagcugauc   aguaguu cugau  agc        aau  aaguucuuuuguauauu gagaaugcgu cacu   g
   -----          aau       a     ga   -uacuaau   cg                 a          a    uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000056.5: 6903412-6903574 [+]
intergenic
Database links

Mature sequence ame-miR-6005-5p

Accession MIMAT0023549
Sequence

58 - 

auaugaacucuuauguacguga

 - 79

Get sequence
Evidence experimental; SOLiD [1], Illumina [3-5]

Mature sequence ame-miR-6005-3p

Accession MIMAT0023550
Sequence

90 - 

acaugcguaagagauuauaugu

 - 111

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).
3
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).
4
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
5
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).