Stem-loop sequence ame-mir-2765

AccessionMI0020216 (change log)
DescriptionApis mellifera miR-2765 stem-loop
Gene family MIPF0001008; mir-2765
Stem-loop
   auuac         -  uu  u     -c   a        ggaa 
5'      ugugucgag ga  gg aacuc  acc ccguuggc    u
        ||||||||| ||  || |||||  ||| ||||||||    c
3'      gcgcggcuc cu  cc uugag  ugg gguaaccg    u
   guaaa         u  -u  u     ca   -        auaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000062.5: 5128388-5128476 [-]
intergenic
Database links

Mature sequence ame-miR-2765-5p

Accession MIMAT0023551
Sequence

18 - 

ugguaacuccaccaccguuggc

 - 39

Get sequence
Evidence experimental; SOLiD [1], Illumina [3-5]

Mature sequence ame-miR-2765-3p

Accession MIMAT0023552
Sequence

53 - 

caaugggguacgaguuuccuuc

 - 74

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).
3
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).
4
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
5
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).