Stem-loop sequence sly-MIR6022

AccessionMI0020238 (change log)
DescriptionSolanum lycopersicum miR6022 stem-loop
Gene family MIPF0001588; MIR6022
Literature search

9 open access papers mention sly-MIR6022
(24 sentences)

Stem-loop
                     g            a                c      c    caa        ---      a   a    u      ucaauucaaaacuucaugaaccuaacgcgac 
5' cccugaacggaacaauac auccuggauauu uccuuuccaucacuaa uuauuu ggcu   aguuuuaa   guugca ggu cucu ccuaag                               u
   |||||||||||||||||| |||||||||||| |||||||||||||||| |||||| ||||   ||||||||   |||||| ||| |||| ||||||                                
3' gggacuugccuuguuaug uaggaccuauaa agggaagguagugauu aauaaa cugg   ucaaaauu   uaacgu cca gaga ggguuc                               u
                     g            g                c      u    --c        ggu      g   g    u      uaacuccaaagcauuuuacauugaauucuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr11: 3158675-3158925 [+]
intergenic
Database links

Mature sequence sly-miR6022

Accession MIMAT0023590
Sequence

211 - 

uggaagggagaauauccagga

 - 231

Get sequence
Evidence not experimental

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).