Stem-loop sequence ame-mir-6050

AccessionMI0020321 (change log)
DescriptionApis mellifera miR-6050 stem-loop
Stem-loop
   gcga    c -----g  --gg         g   aac  ag       ucaa 
5'     gacu g      cg    uuguggagg ugg   ga  guaaaag    g
       |||| |      ||    ||||||||| |||   ||  |||||||     
3'     cuga c      gc    agcacuuuu acc   cu  uauuuuc    u
   ---g    a aaacaa  auga         a   -cc  au       ucuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 4598907-4599003 [-]
intergenic
Database links

Mature sequence ame-miR-6050-5p

Accession MIMAT0023674
Sequence

11 - 

gcggguuguggaggguggaa

 - 30

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).