Stem-loop sequence ame-mir-6052

AccessionMI0020323 (change log)
DescriptionApis mellifera miR-6052 stem-loop
Stem-loop
   aaaauaa     -      --g   gaa        -a     u 
5'        auuau gcaaaa   cua   cucauaga  uauaa u
          ||||| ||||||   |||   ||||||||  |||||  
3'        uaaua cguuuu   gau   gaguaucu  auauu u
   guuauaa     u      aua   -gc        ac     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000056.5: 6138324-6138408 [+]
intergenic
Database links

Mature sequence ame-miR-6052-5p

Accession MIMAT0023676
Sequence

11 - 

augcaaaagcuagaacucauaga

 - 33

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).