Stem-loop sequence ame-mir-6063

AccessionMI0020334 (change log)
DescriptionApis mellifera miR-6063 stem-loop
Stem-loop
   gc  -aacg     g     ---        u g   ---    a 
5'   ga     caccg ugucu   aucgaucg u gau   ucgc g
     ||     ||||| |||||   |||||||| | |||   ||||  
3'   cu     guggc gcaga   uagcuagc a cua   agcg c
   uu  aaaaa     -     agc        u g   ggu    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 1669345-1669428 [+]
intergenic
Database links

Mature sequence ame-miR-6063-3p

Accession MIMAT0023687
Sequence

53 - 

aucgaucgaucgaagacgcggu

 - 74

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).