Stem-loop sequence ame-mir-6064

AccessionMI0020336 (change log)
DescriptionApis mellifera miR-6064 stem-loop
Stem-loop
   -   au       -  a        a        auau    c 
5'  gaa  guucuuu ug aauuuugc acgagacg    uaau c
    |||  ||||||| || |||||||| ||||||||    ||||  
3'  cuu  uaaggag ac uuaaaacg ugcucugu    guug a
   u   gc       c  c        c        -aac    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000058.5: 9166798-9166882 [+]
intergenic
Database links

Mature sequence ame-miR-6064-5p

Accession MIMAT0023689
Sequence

11 - 

uuugaaauuuugcaacgagacg

 - 32

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).