Stem-loop sequence mes-MIR167a

AccessionMI0020962 (change log)
DescriptionManihot esculenta miR167a stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

5 open access papers mention mes-MIR167a
(20 sentences)

Stem-loop
   uguugguuugagagguugaagcugccagcaugaucugguaaugaucuaaccaaaaccuuucuauacguagaccuauauuuauauuucuauacacaucaagcuauggauuauuaaauuuccaguuuucguuacaaaguuuucugcua         caa   u     caauuuuuaccaagggaaaggauuua 
5'                                                                                                                                                   uauuccuuu   uua gcuau                          c
                                                                                                                                                     |||||||||   ||| |||||                          g
3'                                                                                                                                                   auaaggaga   aau cgaug                          a
   -------------------------------------------------------------------------------------------------------------------------------------uuguuaguccuug         -aa   c     uuccuauauacccaugaaaagucaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold12065: 33218-33472 [+]
intergenic
Database links

Mature sequence mes-miR167a

Accession MIMAT0024413
Sequence

17 - 

ugaagcugccagcaugaucug

 - 37

Get sequence
Evidence not experimental

References

1
"Overview of the potential of microRNAs and their target gene detection for cassava (Manihot esculenta) improvement" Amiteye S, Corral JM, Sharbel TF African J Biotech. 10:(2011).