Stem-loop sequence mes-MIR168a

AccessionMI0020963 (change log)
DescriptionManihot esculenta miR168a stem-loop
Gene family MIPF0000081; MIR168
Literature search

4 open access papers mention mes-MIR168a
(12 sentences)

Stem-loop
         g       ua     c          u     a ug   a     gcuugcauauguacguauauguuuucuccuuauua 
5' uuaccg cggucuc  auucg uuggugcagg cggga c  auu gcuuc                                   u
   |||||| |||||||  ||||| |||||||||| ||||| |  ||| |||||                                    
3' aguggc gccagag  uaagu aacuacguuc gcccu g  uaa cgaag                                   g
         -       gc     c          c     a gu   g     acaggcuagaguugguuaguucugaacgguagacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02477: 27011-27183 [-]
intergenic
Database links

Mature sequence mes-miR168a

Accession MIMAT0024414
Sequence

19 - 

ucgcuuggugcaggucgggaa

 - 39

Get sequence
Evidence not experimental

References

1
"Overview of the potential of microRNAs and their target gene detection for cassava (Manihot esculenta) improvement" Amiteye S, Corral JM, Sharbel TF African J Biotech. 10:(2011).